Séquençage NGS haut-débit

Search for virulence and resistance genes and check for mutations Validate your bacterial production stem Characterize microbial isolates by MLST Introduction Due to the emergence of powerful next generation sequencing (NGS) technol - ogies, it has never been easier to rese - quence whole genomes. In case a fully annotated reference genome exists, resequencing may be used to compare differences between genomes of indi - viduals from the same species (please see our de novo service if no reference exists). Using results from such measure - ments, researchers may search for viru - lance, resistance and toxin genes, study inherited or acquired mutations and characterize microbial isolates by multi locus sequence typing. Besides offering our customers state-of-the-art NGS plat - forms, Microsynth has also made signif - icant investments in the bioinformatics analysis area. This application note will give you an overview of Microsynth’s various services in the field of micro - bial resequencing as well as its possible impact on your research. Resequencing of Prokaryotic Organisms Microsynth’s Competences and Services With more than 10 years of experience in the field of next generation sequencing, one of Microsynth’s core competences is to provide high quality one-stop ser - vices from experimental design to bio - informatics analysis. You may either out - source the entire analysis or only single steps to us as illustrated in Figure 1 . Experimental Design Microsynth’s NGS specialists will help you define suitable experimental setups for your resequencing projects and discuss possible strategies to address your research questions. DNA Isolation You may either perform the DNA extrac - tion yourself or outsource this critical step to Microsynth. We have long-stand - ing experience in processing various sample matrices and DNA/RNA sources. Library Preparation and Sequencing Following a quality check of your samples, Microsynth will construct Illumina libraries including specific adaptors with barcodes. Depending on the experimental design, the libraries are pooled and sequenced on the Illumina NextSeq 500/550 platform. By offer - ing datapackages for this service, flex - ible sequencing of any sample number is possible. Figure 1. Microsynth’s workflow for resequencing projects. The workflow can be entered and exited at various steps depending on the requirements of the customer. Resequencing AnalysisProject Output: Samples DNA Isolation Library Preparation Illumina Sequencing Option I: Samples Option II: Isolated DNA Project Input: Report Generation Option III: Bioinformatics only Experimental Design Option I: Library Prep only Option II: Raw Data only Option III: Full Report Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41ff71ff722ff83 33 ? Fax + 41ff71ff722ff87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing Example Results Bioinformatics Analysis Sequencing reads are quality filtered and mapped against the reference genome of the organism to be studied. After further refinement based on best practices, pos - sible single nucleotide variations (SNVs) and small insertions and deletions (InDels) are detected and annotated (see Table 1 ). One or multiple variant callers may be used at once, thus searching in a sensitive or specific way depending on the goals of the study. Whole genome sequencing (WGS) data may also be used for Multi Locus Sequence Type (MLST ) microbial isolates using predefined loci and reference databases (see Figure 2 ). If there is no prior knowledge, sequenced reads may be de novo assembled and predicted genes are screened against community accepted database contain - ing resistance, virulence and toxin genes (see Table 2 ). Beside the sequencing raw data and the output of the bioinformatics analysis, a user-friendly summary report is pro - vided. Provided Output Files: Raw data: Fastq Mapping: BAM/BAI files Variant calling, protein consequences: VCF (for each sample separately) and HTML (includes all samples). Table 1. SNV und InDels - Typical output overview file (HTML) resulting from the variant calling step for SNVs and small InDels. For each sample and chromosome/ contig, the SNV and small InDels are reported separately and the effect of SNVs and small InDels for all annotated features of the reference genome are shown. Besides the html format the data are also given in tab separated format (to import into Excel) and as vcf. Figure 2. MLST subtree: As an illustrative example, a small subtree of all phy - logenetic profiles stored on the PubMLST database [3] of the Cronobacter sequence type is depicted. A customer sample would be placed into its appro - priate phylogenetic context to determine its exact sequence type or its next relative. Sam ple _ID R esis ta n ce g e n es V ir u le n ce g e n es T o xin g e n es Sa m ple _1 f o sB 1 - - S a m ple _2 - a stA 1 - Sa m ple _3 - -TR I1 Table 2. Exemplary cut-out of a table with screening results for resistance, viru - lence and toxin genes. Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41ff71ff722ff83 33 ? Fax + 41ff71ff722ff87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing

Compare gene expression profiles obtained under different conditions Study genetic profiles from transcript to pathway level Introduction RNA sequencing, the analysis of gene expression profiles by next generation sequencing (NGS), has become a pow - erful tool to investigate the transcrip - tome of an organism. The comparison of two or more conditions (e.g. mutant vs. wild type) allows the identification of differentially expressed genes that are up- or downregulated under a specific condition. Typical applications include the comparison of gene expression pro - files between normal and cancer tissue, cells in high and low nutrient environ - ments, stressed and unstressed cells or cells from distinct developmental stages. Major prerequisites for any RNA sequencing study are the availability of an annotated reference genome or tran - scriptome and sufficient numbers of bio - logical replicates. mRNA Sequencing for Differential Gene Expression Analysis Microsynth’s Competences and Services Differential gene expression analysis by RNA sequencing is one of Microsynth’s core competences. Based on years of experience, we provide a one-stop service from experimental design to bioinformatics analysis (see Figure 1 ). You can either outsource the whole process or only single steps to us. To ensure a high reliability and accuracy of our product, the whole RNA sequenc - ing pipeline including the bioinformat - ics analysis was evaluated and validated based on RNA spike-ins designed by the External RNA Control Consortium (ERCC). For further information on our validation process and possibilities to validate your own study, please contact us. Experimental Design The gain and impact of a study highly depends on its experimental design. The use of controls as well as appropri - ate sampling and RNA isolation methods are only a few examples of points to con - sider. What is important for any RNA sequencing project is the number of biological replicates. To obtain statisti - cally valid results for a differential gene expression analysis, we usually advise to include at least three biological rep - licates per condition. Make use of our experience – our NGS specialists are happy to assist you from the start. RNA Isolation You can either perform the extraction yourself or outsource this critical step to us. Microsynth has extensive experience in RNA isolation from various demand - ing tissues and matrices. Figure 1. Microsynth's workflow for RNA sequencing projects. The workflow can be entered and exited at various steps dependent on the customer's requirements. Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing Example Results The major outcomes of the differen - tial gene expression analysis are the observed fold changes for each gene together with statistical measures and the normalized counts per sample (see Figure 2A ). Statistics for all genes are additionally summarized in an interac - tive table together with boxplots visu - alizing the observed fold changes (see Figure 2B ). The interactive table allows you to sort the data by any represented measure or to search for specific features of interest. Library Preparation and Sequencing Following a quality check of the RNA, we will either perform poly(A) enrich - ment or ribosomal RNA (rRNA) depletion, depending on the organism or the target RNA to be studied. This step is essential since total RNA includes a large fraction of rRNA and other non-mRNA species and sequencing should be restricted to mRNA to avoid losses in sequencing depth. A stranded Illumina cDNA library is created by reverse transcription including the ligation of sequencing adaptors with barcodes. Finally, the libraries are pooled and sequenced on the Illumina NextSeq platform with a typical single-end read length of 75 bp. The sequencing depth per sample highly depends on the studied organisms and the desired sen - sitivity. Benchmarks for complex eukar - yotic genomes (e.g. human, rat, mouse) are 100-150 million reads for high sensi - tivity and 20-30 million reads for typical sensitivity. Prokaryotic genomes require approximately 5-fold less reads. Bioinformatics Analysis After quality control, the sequenc - ing reads are mapped to the reference genome using the software Salmon [1] or STAR [2], which both address the diffi - culty of mapping spliced reads. As input for statistical analysis the reads that uniquely map to a gene are counted. The identification of differentially expressed genes is performed by specialized statis - tical software such as DESeq2 [3]. Read counts are normalized, and the vari - ance based on the replicates per con - dition is calculated. Finally statistical testing is applied to identify differentially expressed genes that are significantly up- or downregulated. For organisms with available pathway information, a complementary service is provided identifying significantly up- or downregulated pathways (Gene ontol - ogy and KEGG classification). Figure 2. Summary tables resulting from the dif - ferential gene expression analysis. 2A. Excerpt of a table summarizing the results of the analysis for two conditions with three replicates each. ID: gene ID; baseMean: average number of read counts; log2FC: log2 transformed fold change between conditions; lfcSE: standard error of log fold change; p-value: Wald test p-value; padj: p-value adjusted for multi - ple testing. 2B. The statistical results are also avail - able as an interactive html-table allowing sorting and searching for specific features. 2U6pV
$I?Vr”AHV@c3gG7( 47br@21 &UV6’"p@C3 9t€uYuB%1T @21&UV6’"p@C3 "Qpf3Aap )v)8 uBeY(X 1$a yy•CS•5)„b0$5wv@(Q˜ 76ed6!)v3 2`4g‡ #B2% 9YcG
4‰VB Sx‰H 85S "3pˆ 3b2i 8`”„P'’ˆ&t3V3"`8qY5e BC$$ GH cBGh0x—‘ F9` 4UD%rTt –G8s 7r64 ’’€4„y5u Rb™?G@u?B5gG‘)8p!U5A”gg !aA6 rƒ€(7ƒWP cS•@y2i‚ •04 %“„S”&@ 09 09 #IH) "A70
1@p"06s& 0‘cb 7“–G™ i˜bbr ˜‚h€ Ea9 2
–C76c‚ (†“q †“r PS% i“q'@#v#`UdH1 ‚(W ƒC( )8 ?@8€P7`T $ay„ B‰u„ ?„Bb€–ywB Pp5d 1ƒ$P "vv@ `F“?FI

W‘3?‰%8rsE! B #1D?5„?…8G‰ip9B H !9%f 9W“Fe#BQ€s &TQG P(T 7G —3S†“@ '”0dT?f0`8—tXQ˜…€ Bah‘† tR—… 4i1UA $?26 r™? I—PbgeI2P y…p $S`uP "PTR 7—9˜XY(2SAtAs’IRIe (hu‚3 Pb‘w1YPQ"1u W—q #y$%`&cf" $’i&$ &˜6C dX“ 8C#”9’T‚P&Cˆy79™™Q $%€$82—' `„“P 'c Q6`q? 5hP` 8`‰Tp‘& eE‰p %C™8t‡Ib@"14—T u%
??TeY(X A 8Q€gc# %ˆT%ˆS0 s?V & 0„xuB 'rX9uB #pS" 9†q4 uB 'rX9uB #pS" 9†q4 uB 'rX9uB )eYy –
w9@ tDb 9I”X’ Yt™ 1u4P` B Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing UYQ% A„ Y˜‡ƒ0 (”fI $GF3i 7PQ(F !`@t˜ % A„ 0VPT€ 5Fa™‡ uBuBuB 5ES• —f„g` •R B9d?V 6YiWp X(aC Xxht? 3•‘V@ 1x 2b ` A•IH #f—% sˆ8v For each comparison in the differen - tial gene expression analysis, various graphs are provided for an easy and visual overview of the results (see Figure 3). The graphs include MA plots visualiz - ing the distribution of the differentially expressed genes, heatmaps for sample to sample distances and the top up- and downregulated genes as well as principal component analysis plots. Figure 3. Examples of provided overview plots. 3A. MA-plot visualizing the distribution of differentially expressed genes by plotting the mean expression against the log fold change. 3B. Principle Component Analysis plot to visualize sample clustering. 3C. Heatmap showing sample to sample distances for given conditions. 3D. Heatmap displaying the 30 most upregulated genes. A similar heatmap is provided for the most downregulated genes, both allowing an easy identification of puta - tive candidate genes. A B C D Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41ff71ff722ff83 33 ? Fax + 41ff71ff722ff87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing References [1] Patro, R., Duggal, G., Love, M. I., Irizarry, R. A., & Kingsford, C. (2017). Salmon provides fast and bias-aware quantification of transcript expression. Nature Methods. [2] Dobin et al. (2013) STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21. https://doi.org/10.1093/bioinformatics/bts635 [3] Love et al. (2014) Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15. https://doi.org/10.1186/s13059-014- 0550-8 The results for the complementary pathway analysis include graphical rep - resentations of the up- and downreg - ulated pathways for both gene ontol - ogy and KEGG terms (see Figure 4 ). The pathway analysis module is available for most common model organisms such as human, mouse, rat or E. coli . Information is provided for all genes involved in a pathway count and log fold change, allowing a more detailed analysis of the identified pathways. Figure 4. Graphical output of the pathway analysis module. 4A. Excerpt from a network graph for upregulated pathways where colored nodes represent significantly upregulated gene ontology terms. 4B. Detail of a KEGG pathway analysis result. Both are available for up- and downregulated pathways. Related Services For the analysis of the small RNA frac - tion (e.g. microRNA) of an organism, please refer to our small RNA sequenc - ing service. If you are interested in the transcriptional analysis of whole micro - bial communities, our shotgun meta - transcriptomics service offers an attrac - tive solution. A B Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fl71fl722fl83 33 ? Fax + 41fl71fl722fl87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing

Detect introduced or expected mutations Discover rare genomic variations with high confidence Introduction Amplicon deep sequencing using next generation sequencing (NGS) technolo - gies has become a powerful tool to study a wide variety of research questions. Typical applications include (i) CRISPR genome editing protocols of eukaryotes, (ii) genome-wide transposon insertion analysis in microorganisms, (iii) human leukocyte antigen (HLA) typing and (iv) screening of specific somatic muta - tions in tumor tissues. Common to all these approaches is that a PCR is used to amplify fragments, which are then sequenced on a single-molecule level. The Two-Step PCR Approach – How it Works The two-step PCR approach combined with Illumina’s dual indexing strategy allows to process up to 384 samples in parallel (see Figure 1 ). The first-step PCR uses primers contain - ing a locus-specific sequence as well as a universal 5’ tail as specified in the Nextera library protocol from Illumina (see Table 1 ). Instead of using only one single forward and reverse primer, some proto - cols make use of up to 3 forward primers that differ in length by adding wobble bases (Ns) between the locus-specific and common 5’ tail. This might be espe - cially useful in high-throughput projects where the sequencing throughput is especially critical and many samples are pooled. However, for most projects the sequencing throughput is high enough by simply using one forward and one reverse primer. If you need further back - ground about this particular topic, please contact us. The resulting PCR amplicons are then used as templates within the second-step PCR for further amplification, but also to include the indexes (barcodes) as well as the Illumina adaptors. The Illumina indexing strategy for the second-step PCR consists of 16 forward primers and 24 reverse primers. The combinatorial use of these primers (16 x 24) defines the maximal number of 384 samples which can be pooled and sequenced on one Illumina MiSeq/NextSeq run. Amplicon Deep Sequencing on the lllumina MiSeq/NextSeq Platform Start of For Read Start of Rev Read First-Step PCR Second-Step PCR i5_S5xy barcode i7_N7xy barcode Figure 1. Overview of the double indexing strategy used in the Illumina two-step protocol. During the Illumina sequencing step the amplified genomic sequence including the specific primers (grey and blue bars) as well as the forward and reverse barcodes (orange bar) are read out. Table 1. 5’ tails used for the first-step PCR. Oligonucleotide sequences © 2007-2013 Illumina, Inc. All rights reserved. Primer Name Sequence (5‘-3‘) 1st_PCR_for TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific sequence] 1st_PCR_rev GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[locus-specific sequence] Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing Table 2. Indexed forward primers for the second-step PCR. Oligonucleotide sequences © 2007-2013 Illumina, Inc. All rights reserved. Primer Name Sequence (5‘-3‘)Sequence (5‘-3‘) NGS_i5_S502 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific AATGATACGGCGACCACCGAGATCTACAC CTCTCTAT TCGTCGGCAGCGTC NGS_i5_S503 AATGATACGGCGACCACCGAGATCTACAC TATCCTCT TCGTCGGCAGCGTC Index NameIndex Name TCGTCGGCAG - S502 (set A/B) S503 (set A/B) Index NameIndex Sequence TCGTCGGCAG - CTCTCTAT TATCC TC T NGS_i5_S505 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific AATGATACGGCGACCACCGAGATCTACAC GTAAGGAG TCGTCGGCAGCGTC NGS_i5_S506 AATGATACGGCGACCACCGAGATCTACAC A C T G C ATA TCGTCGGCAGCGTC TCGTCGGCAG - S505 (set A/B) S506 (set A/B) TCGTCGGCAG - GTAAGGAG A C TG C ATA NGS_i5_S507 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific AATGATACGGCGACCACCGAGATCTACAC AAGGAGTA TCGTCGGCAGCGTC NGS_i5_S508 AATGATACGGCGACCACCGAGATCTACAC CTAAGCCT TCGTCGGCAGCGTC TCGTCGGCAG - S507 (set A/B) S508 (set A/B) TCGTCGGCAG - AAGGAGTA CTAAGCCT NGS_i5_S510 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific AATGATACGGCGACCACCGAGATCTACAC CGTCTAAT TCGTCGGCAGCGTC NGS_i5_S511 AATGATACGGCGACCACCGAGATCTACAC TCTCTCCG TCGTCGGCAGCGTC TCGTCGGCAG - S510 (set A/B) S511 (set A/B) TCGTCGGCAG - CGTCTAAT TC TC TCCG NGS_i5_S513 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific AATGATACGGCGACCACCGAGATCTACAC TCGACTAG TCGTCGGCAGCGTC NGS_i5_S515 AATGATACGGCGACCACCGAGATCTACAC TTCTAGCT TCGTCGGCAGCGTC TCGTCGGCAG - S513 (set C/D) S515 (set C/D) TCGTCGGCAG - TCGACTAG TTCTAGCT NGS_i5_S516 AATGATACGGCGACCACCGAGATCTACAC CCTAGAGT TCGTCGGCAGCGTC NGS_i5_S517 AATGATACGGCGACCACCGAGATCTACAC GCGTAAGA TCGTCGGCAGCGTC S516 (set C/D) S517 (set C/D) CCTAGAGT GCGTAAGA NGS_i5_S518 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific AATGATACGGCGACCACCGAGATCTACAC C TAT TA AG TCGTCGGCAGCGTC NGS_i5_S520 AATGATACGGCGACCACCGAGATCTACAC AAGGCTAT TCGTCGGCAGCGTC TCGTCGGCAG - S518 (set C/D) S520 (set C/D) TCGTCGGCAG - C TAT TA A G AAGGCTAT NGS_i5_S521 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific AATGATACGGCGACCACCGAGATCTACAC GAGCCTTA TCGTCGGCAGCGTC NGS_i5_S522 AATGATACGGCGACCACCGAGATCTACAC TTATGCGA TCGTCGGCAGCGTC TCGTCGGCAG - S521 (set C/D) S522 (set C/D) TCGTCGGCAG - GAGCCTTA TTATGCGA Table 3. Indexed reverse primers for the second-step PCR. Oligonucleotide sequences © 2007-2013 Illumina, Inc. All rights reserved. Primer Name Sequence (5‘-3‘)Sequence (5‘-3‘) NGS_i7_N701 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT TCGCCT TA GTCTCGTGGGCTCGG NGS_i7_N702 CAAGCAGAAGACGGCATACGAGAT C TAG TACG GTCTCGTGGGCTCGG Index NameIndex Name TCGTCGGCAG - N701 (set A/C) N702 (set A/C) Index NameIndex Sequence TCGTCGGCAG - TCGCCT TA C TA G TA C G NGS_i7_N703 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT T TCTGCCT GTCTCGTGGGCTCGG NGS_i7_N704 CAAGCAGAAGACGGCATACGAGAT GCTCAGGA GTCTCGTGGGCTCGG TCGTCGGCAG - N703 (set A/C) N704 (set A/C) TCGTCGGCAG - T TC TGCC T GCTCAGGA NGS_i7_N705 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT AGGAGTCC GTCTCGTGGGCTCGG NGS_i7_N706 CAAGCAGAAGACGGCATACGAGAT C AT G C C TA GTCTCGTGGGCTCGG TCGTCGGCAG - N705 (set A/C) N706 (set A/C) TCGTCGGCAG - AGGAGTCC C ATG C C TA NGS_i7_N707 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT GTAGAGAG GTCTCGTGGGCTCGG NGS_i7_N710 CAAGCAGAAGACGGCATACGAGAT CAGCCTCG GTCTCGTGGGCTCGG TCGTCGGCAG - N707 (set A/C) N710 (set A/C) TCGTCGGCAG - GTAGAGAG CAGCCTCG NGS_i7_N711 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT TGCCTCT T GTCTCGTGGGCTCGG NGS_i7_N712 CAAGCAGAAGACGGCATACGAGAT TCCTCTAC GTCTCGTGGGCTCGG TCGTCGGCAG - N711 (set A/C) N712 (set A/C) TCGTCGGCAG - TGCC TC T T TCC TC TAC NGS_i7_N714 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT TCATGAGC GTCTCGTGGGCTCGG NGS_i7_N715 CAAGCAGAAGACGGCATACGAGAT CCTGAGAT GTCTCGTGGGCTCGG TCGTCGGCAG - N714 (set A/C) N715 (set A/C) TCGTCGGCAG - TCATGAGC CCTGAGAT NGS_i7_N716 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT TAGCGAGT GTCTCGTGGGCTCGG NGS_i7_N718 CAAGCAGAAGACGGCATACGAGAT GTAGCTCC GTCTCGTGGGCTCGG TCGTCGGCAG - N716 (set B/D) N718 (set B/D) TCGTCGGCAG - TAGCGAGT GTAGCTCC NGS_i7_N719 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT TAC TACG C GTCTCGTGGGCTCGG NGS_i7_N720 CAAGCAGAAGACGGCATACGAGAT AGGCTCCG GTCTCGTGGGCTCGG TCGTCGGCAG - N719 (set B/D) N720 (set B/D) TCGTCGGCAG - TA C TA C G C AGGCTCCG NGS_i7_N721 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT GCAGCGTA GTCTCGTGGGCTCGG NGS_i7_N722 CAAGCAGAAGACGGCATACGAGAT CTGCGCAT GTCTCGTGGGCTCGG TCGTCGGCAG - N721 (set B/D) N722 (set B/D) TCGTCGGCAG - GCAGCGTA CTGCGCAT NGS_i7_N723 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT GAGCGCTA GTCTCGTGGGCTCGG NGS_i7_N724 CAAGCAGAAGACGGCATACGAGAT CGCTCAGT GTCTCGTGGGCTCGG TCGTCGGCAG - N723 (set B/D) N724 (set B/D) TCGTCGGCAG - GAGCGCTA CGCTCAGT NGS_i7_N726 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT GTCTTAGG GTCTCGTGGGCTCGG NGS_i7_N727 CAAGCAGAAGACGGCATACGAGAT ACTGATCG GTCTCGTGGGCTCGG TCGTCGGCAG - N726 (set B/D) N727 (set B/D) TCGTCGGCAG - GTCTTAGG AC TGATCG NGS_i7_N728 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific CAAGCAGAAGACGGCATACGAGAT TAGCTGCA GTCTCGTGGGCTCGG NGS_i7_N729 CAAGCAGAAGACGGCATACGAGAT GACGTCGA GTCTCGTGGGCTCGG TCGTCGGCAG - N728 (set B/D) N729 (set B/D) TCGTCGGCAG - TAGCTGCA GACGTCGA How to Order the NGS Primers? First, download the specific “OrderForm_ IlluminaAmpliconDeepSeq” from Microsynth’s website (see Amplicon Deep Sequencing within the NGS menu). Next, specify the locus-specific sequences for your first-step PCR primers, and then Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing Example of Primer Pipetting Scheme for 96 Samples (8 x 12 indexes) PCR Design Considerations In general, the first-step PCR is a standard PCR using a proofreading polymerase and 5’ tailed PCR primers. The only point to consider is the length (up to 500  bp) of the amplified product including the locus-specific parts of the forward and reverse primers. If the sequence of the entire amplicon is of interest, the Illumina forward and reverse reads may be merged to reconstruct the full length molecule. Single-end run configurations are also possible depending on your specific question. Please contact us to discuss your options. S502 N701 S502 N702 S502 N703 S502 N704 S502 N705 S502 N706 S502 N707 S502 N710 S502 N711 S502 N712 S502 N714 S502 N715 S503 N701 S503 N702 S503 N703 S503 N704 S503 N705 S503 N706 S503 N707 S503 N710 S503 N711 S503 N712 S503 N714 S503 N715 S505 N701 S505 N702 S505 N703 S505 N704 S505 N705 S505 N706 S505 N707 S505 N710 S505 N711 S505 N712 S505 N714 S505 N715 S506 N701 S506 N702 S506 N703 S506 N704 S506 N705 S506 N706 S506 N707 S506 N710 S506 N711 S506 N712 S506 N714 S506 N715 S507 N701 S507 N702 S507 N703 S507 N704 S507 N705 S507 N706 S507 N707 S507 N710 S507 N711 S507 N712 S507 N714 S507 N715 S508 N701 S508 N702 S508 N703 S508 N704 S508 N705 S508 N706 S508 N707 S508 N710 S508 N711 S508 N712 S508 N714 S508 N715 S510 N701 S510 N702 S510 N703 S510 N704 S510 N705 S510 N706 S510 N707 S510 N710 S510 N711 S510 N712 S510 N714 S510 N715 S511 N701 S511 N702 S511 N703 S511 N704 S511 N705 S511 N706 S511 N707 S511 N710 S511 N711 S511 N712 S511 N714 S511 N715 N701 N702 N703 N704 N705 N706 N707 N710 N711 N712 N714 N715 S502 S503 S505 S506 S507 S508 S510 S511 Table 4. Pipetting scheme for barcoding 96 samples using 8 i5 indexes (vertical) and 12 i7 indexes (horizontal). Using the 16 x 24 described indexes of Illumina it is also possible to unequivocally indentify up to 384 samples. Microsynth Competences and Services One of Microsynth’s core skills is in the field of amplicon deep sequencing. Microsynth is able to offer its customers a non-stop service covering the entire process from experimental design plan - ning, DNA isolation, PCR amplification and sequencing up to bioinformatics analysis of the generated data for typical deep sequencing projects (see Figure 2 ). DNA Isolation: Either the customer pro - vides isolated DNA or outsources this step to Microsynth (>13 years of experi - ence in DNA/RNA isolation from various and demanding matrices). PCR Amplification: The PCR amplifica - tion will use a state-of the-art high-fidel - ity polymerase resulting in high-quality multiplex amplicon libraries. The cus - tomer either provides the DNA, the first- step PCR products, or the second-step products. The advantage of providing the first-step PCR products is that you will only need two primers per locus and do not need to order any indexed primers. PCR products are purified, quantified with fluorescence spectroscopy and pooled in equimolar amounts. NGS Sequencing: Sequencing is done using Illumina MiSeq/NextSeq sequenc - ing technology. Both technologies allow high-throughput profiling at low costs, and the MiSeq has the additional advan - tage of long reads. Bioinformatics Analyses: Depending on customer requirements, Microsynth can offer customized analysis of the data including demultiplexing, QC of the sequence data, paired-end read merging, mapping and identification of InDels and SNVs and analysis of their like - lihood. For gene editing specific analy - sis (e.g. CRISPR/Cas), please also consult the gene editing application note. select your desired indexed forward and reverse primers. Send the upload sheet to info@microsynth.ch and request your specific offer. Alternatively, directly order the oligos in our webshop using the prefix “NGS_” in the 0.2 ?mol scale, HPLC purified. Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing Figure 2. Typical steps in a amplicon deep-se - quencing project. Depending on researcher needs, Microsynth can deliver a one-stop service encom - passing DNA isolation, PCR amplification and sequencing, and customized data analysis. 010 2030 40 050 100 150 200 Distribution of Deletion s Size (bp) count 0 50 100 150 0500 1000 1500 Distribution of Mutation s Position (bp) count Alottment of Mutated Positions A: Sample 01 B: Sample 02 C: Sample 03 D: Sample 04 A B C D 9 3 3 8 0 1 9 4 9 3 24 2 2 0 2 Example Outputs for an Amplicon Deep-Sequencing Project A B C Figure 3. Example output of a deep-sequencing project. Sequencing reads of individual samples are aligned to the reference, and the distribution of SNPs (3A) and Indels (3B) are reported. In addition, Veen diagrams are displayed to visualize the number of mutations shared by the different samples included in the analysis (3C). Amplicon Deep Seq Analysis Project Output: Total DNA Isolation DNA Second Step PCR Illumina MiSeq (long), Illumina NextSeq (deep) Option I: Samples Option II: Isolated DNA Project Input: Report Generation Option IV: Bioinformatics only Experimental Design Option I: Library Prep only Option II: Raw Data only Option III: Full Report First Step PCR with Custom or Standard Primer Set Option III: First Step Products Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing

Determine the sequence type of microbial isolates Screen for resistance, virulence, and mycotoxin genes Identify genetic variations that lead to pathogenicity Introduction Genomic epidemiology studies are useful to support public health, combat infectious diseases, maintain food safety, or establish sustainable produc - tion lines. To support our customers in these diverse applications, Microsynth has developed a genomic epidemiology pipeline that allows addressing numer - ous scientific topics concerning your epidemiology project: • Resolve the taxonomy of individual species or sequence type (ST ) • Identify resistance, virulence and myco - toxin genes • Detect multidrug resistant bacterial pathogens (MDR) • Detect acquired mutations and assess their potential functional effects • Establish a population-level profiling and comparison of antimicrobial resis - tance Our genomic epidemiology analysis pipeline is based on next generation whole genome sequencing. The gener - ated data and knowledge will support production lines, can be used to track transmission, or used in pathogen out - break surveillance, to just name a few examples. At Microsynth we will guide you through the whole analysis to assure you will achieve your goals. Genomic Epidemiology Analysis Microsynth’s Competences and Services With more than 10 years of experience in the field of next generation sequencing, one of Microsynth’s core competences is to provide high quality one-stop ser - vices from experimental design to bio - informatics analysis. You may either out - source the entire analysis or only single steps to us as illustrated in Figure 1 . Experimental Design Microsynth’s NGS specialists will help you define suitable experimental setups for your genomic epidemiology analysis projects and discuss possible strategies to address your research questions. DNA Isolation You may either perform the DNA extrac - tion yourself or outsource this critical step to Microsynth. We have long-stand - ing experience in processing various sample matrices and DNA/RNA sources. Figure 1. Microsynth’s workflow for genomic epidemiology analysis projects. The workflow can be entered and exited at various steps depending on the requirements of the customer. Genomic Epidemiology AnalysisProject Output: Staphylococcus aureus DNA Isolation Illumina TruSeq Library Preparation Illumina NextSeq (2x150bp) Sequencing Option I: Samples Option II: Isolated DNA Project Input: Report Generation Option III: Bioinformatics only Experimental Design Option I: Library Prep only Option II: Raw Data only Option III: Full Report Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing Example Results Bioinformatics Analysis Thanks to the use of modern methods and algorithms, hundreds of samples can be analyzed in detail for any genomic epidemiology project. Depending on the focus of the project, many different approaches to bioinformatic analysis are possible, but two example scenarios are described in the next section. In the first example scenario, the genomes contained in the samples come from well-studied model organisms. However, since the composition of the samples is unknown, a shotgun meta - genome analysis is performed first to determine whether the samples contain pure strains or whether meta-communi - ties exist, and in both cases the taxonomy is determined (see Table 1 ). Assuming that the samples contain pure strains of a well-studied micro-organism, one of the established Multi Locus Sequence Typing (MLST ) schemes can be used to determine its sequence type, which goes beyond the determination of the species alone (see Table 2 ). Next, in order to reconstruct the strains contained in the samples, the filtered sequencing reads are de novo assem - bled into contigs on which genes are predicted and annotated. The predicted genes are then screened for homologous sequences among the known resistance, virulence, and mycotoxin genes. Single nucleotide variations (SNVs) and small insertions and deletions (InDels) are determined in comparison to the public reference sequences (see Table 3 ). In the second scenario, the microor - ganisms to be analyzed are neither well studied nor publicly documented. In this case, determining the similarity of the unknown genomes to any of the genomes stored in the RefSeq [1] data - base first and second annotate pre - dicted genes with homologues found for instance in the Pfam [2] database (see Table 4 ) are sensible first steps. If no exact phylogenetic relationship is known for the hundreds of samples involved in a genomic epidemiology project, clus - tering can be used to establish groups of samples that may then be further ana - lyzed on their own [3] (see Figure 2 ). Table 1. This cutout of a result of a shotgun metagenomics taxonomy assignment, shows the composition of the bacterial community found in the analyzed sample. In this case, the sample contains 96 % of the Staphylococcus genus (Tax Level: G) and 92% are identified as Staphylococcus aureus species (Tax Level: S). Table 2. The result of an MLST showing the sequence type of the species found in the sample. In this case, the scheme used for typing included seven genes (arcC, aroE, glpF, gmk, pta, tpi and yqiL) to identify the respective ST and Clonal Complex (CC). The numbers in the gene columns represent different variants of these genes found in the PubMLST database [4]. Table 3. Summary table of the number of observed SNVs and small InDels in the analyzed sample including the type of mutation (silent and non-silent). Percent Tax Level Tax ID Tax Name 100.00 D 2 Bacteria 100.00 P 1239 Firmicutes 100.00 C 91061 Bacilli 96.00 O 1385 Bacillales 96.00 F 90964 Staphylococcaceae 96.00 G 1279 Staphylococcus 92.00 S 1280 Staphylococcus aureus Sample arcC aroE glpF gmk pta tpi yqiL ST Clonal Complex sample1 1 4 1 8 4 4 3 72 CC8 Sample SNV InDels Silent Non-silent sample1 236 12 171 53 Library Preparation and Sequencing Following a quality check of your samples, Microsynth will build Illumina libraries including specific adaptors with barcodes. Depending on the experimen - tal design, the libraries are pooled and sequenced either on the Illumina MiSeq or NextSeq 500/550. These flexible plat - forms allow for optimal sequencing depending on the number of samples and on the required read length. Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing Related Services Microsynth also provides microbial resequencing services that focus on the detection of genetic variations in relation to a refer - ence sequence. References [1] O’Leary NA, Wright MW, Brister JR, Ciufo S, Haddad D, McVeigh R, Rajput B, Robbertse B, Smith-White B, Ako-Adjei D, Astashyn A, Badretdin A, Bao Y, Blinkova O, Brover V, Chetvernin V, Choi J, Cox E, Ermolaeva O, Farrell CM, Goldfarb T, Gupta T, Haft D, Hatcher E, Hlavina W, Joardar VS, Kodali VK, Li W, Maglott D, Masterson P, McGarvey KM, Murphy MR, O’Neill K, Pujar S, Rangwala SH, Rausch D, Riddick LD, Schoch C, Shkeda A, Storz SS, Sun H, Thibaud-Nissen F, Tolstoy I, Tully RE, Vatsan AR, Wallin C, Webb D, Wu W, Landrum MJ, Kimchi A, Tatusova T, DiCuccio M, Kitts P, Murphy TD, Pruitt KD. Reference sequence (RefSeq) database at NCBI: current status, taxonomic expansion, and functional annotation. Nucleic Acids Res . 2016 Jan 4;44(D1):D733-45 PubMed [2] S. El-Gebali, J. Mistry, A. Bateman, S.R. Eddy, A. Luciani, S.C. Potter, M. Qureshi, L.J. Richardson, G.A. Salazar, A. Smart, E.L.L. Sonnhammer, L. Hirsh, L. Paladin, D. Piovesan, S.C.E. Tosatto, R.D. Finn. The Pfam protein families database in 2019. Nucleic Acids Research (2019) doi: 10.1093/nar/gky995 [3] Lees JA, Harris SR, Tonkin-Hill G, Gladstone RA, Lo SW, Weiser JN, Corander J, Bentley SD, Croucher NJ. Fast and flexible bacterial genomic epidemiology with PopPUNK. Genome Research 29:1-13 (2019). doi: 10.1101/gr.241455.118 [4] Website ( https://pubmlst.org/mlst/ ) sited at the University of Oxford (Jolley et al. Wellcome Open Res 2018, 3:124 [version 1; ref - erees: 2 approved]). The development of this site has been funded by the Wellcome Trust. Figure 2. Clustering of a large numbers of samples with unknown phylogenetic relationship resulting in four distinct groups. Table 4. Detail of a table showing the homologous protein domains and their significance found for the predicted genes of the analyzed sample. Target Name Accession Query Name E-value Score Description of Target TPK_catalytic PF04263.16 gene_8|401_aa|-|7047|8252 0.00038 20.5 Thiamin pyrophosphokinase, catalytic domain CRISPR_Cas9_WED PF18061.1 gene_40|840_aa|-|40414|42936 0.12 12.4 CRISPR-Cas9 WED domain Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing

Explore the microbial community composition of your samples Compare taxonomic shifts within a given experimental setup Introduction Microbial communities are present in almost every environment. They are important drivers of biogeochemical processes, have a large influence on human health and harbor enormous potential for biotechnological applica - tions. A major goal in the analysis of a microbial community is to identify its taxonomic composition and diversity. Sequencing of the ribosomal RNA (rRNA) gene and its internal spacer regions has become the gold standard for the identi - fication of microorganisms such as bac - teria, archaea and fungi. Its presence in all living organism, the combination of conserved and hypervariable genetic regions and the availability of curated reference databases make the rRNA gene an ideal phylogenetic marker. The com - bination of next generation sequencing (NGS) of partial regions of the rRNA gene combined with adequate bioinformatics analysis is a powerful tool to explore the composition of microbial communities. Amplicon Metagenomics – 16S/ITS Choice of the Primer System Amplicon metagenomics is based on NGS sequencing of the microbial rRNA gene. Since NGS read lengths are limited, only parts of the rRNA gene can be amplified and sequenced. For prokaryotes, the analysis targets hyper - variable regions (V1-9) on the 16S rRNA gene, while for fungi the internal tran - scribed spacer regions (ITS) are used for taxonomic profiling (see Figure 1 ). An ideal primer system should be uni - versal enough to cover a broad range of taxonomic groups, while the result - ing amplicon must provide enough tax - onomic information for a reliable tax - onomic classification. Based on our experience and the validation of our 16S/ITS analysis pipeline, we recom - mend the primer systems displayed in Table 1 . Our service is not restricted to the displayed marker genes and primer systems, also other phyloge - netic marker genes (e.g. cytochrome c oxidase I) and primer systems can be used. A pilot study can be very helpful to find the best primer system for your specific research question. Figure 1. Overview of loci of ribosomal gene loci commonly used for the taxonomic analysis of microbial communities. Hypervariable regions are marked in green while conserved regions are marked in grey. A. Structure of the prokaryotic 16S rRNA gene showing the nine hypervariable regions (V1-V9) and the regions targeted by the commonly used primer systems. B. Organization of the fungal rRNA gene operon showing two internal transcribed spacer regions (ITS). ITS2 is most often used for profiling fungal communities. Primer Name Sequence (5’-3’) Region Size (bp) Source 515F (Parada) 806R (Apprill) GTGYCAGCMGCCGCGGTAA GGACTACNVGGGTWTCTAAT V4 ~300 [1] 341F 805R CCTACGGGNGGCWGCAG GACTACHVGGGTATCTAATCC V34 ~460 [2] ITS3 ITS4 GCATCGATGAAGAACGCAGC TCC TCCGC T TAT TGATATGC ITS2 300-400 [3] Table 1. Recommended and commonly used universal primer systems for prokaryotic (515F/806R, 341Fl/805R) and fungal (ITS3/ITS4) microbiome profiling. Only template specific sequences are shown. For Illumina-Sequencing the primer sequences must be combined with Illumina adaptor sequences in a two-step PCR approach. For further information consult our application note for Amplicon Deep Sequencing (https:// www.microsynth.ch/amplicon-deep-sequencing.html). Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fl71fl722fl83 33 ? Fax + 41fl71fl722fl87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing Microsynth Competences and Services Microbial community profiling is one of Microsynth’s core competences. Based on our extensive experience, we provide a one-stop service from experimental design to bioinformatics analysis (see Figure 2 ). You can either outsource the whole process or only single steps to us. We validated our whole amplicon metagenomics pipeline and the includ - ing methods by sequencing and analysis of two well characterized mock commu - nities. For further information on our val - idation process and possibilities to vali - date your own study, please contact us. Experimental Design The gain and impact of a study is highly dependent on its experimental design. The use of replicates, controls and appro - priate sampling methods are only a few examples of important points to con - sider. Make use of our experience; our NGS specialists will assist you from the start. DNA Isolation Microorganisms are highly diverse regarding their physiology and are often associated with surfaces like soil particles or are organized in stable agglomera - tions such as biofilms. DNA extraction of complex matrices is challenging. You can either perform the extraction yourself or outsource this critical step. Microsynth has extensive experience in DNA and RNA isolation from various matrices (e.g. soil or feces). PCR Amplification PCR amplification follows a two-step protocol. In a first step the locus-specific sequence is amplified, while in a second step the Illumina sequencing adaptors and indices are added. For projects with very low amounts of starting material we recommend our three-step PCR protocol including two subsequent locus-specific PCRs to increase the yield of sequence- able amplicons. NGS Sequencing Sequencing is performed on the Illumina MiSeq system. The MiSeq allows high throughput profiling at low cost, sup - porting read lengths up to 2x300 bp. Bioinformatics Analysis Microsynth’s amplicon metagenomics analysis is based on up-to-date and pub - lished bioinformatics software such as USEARCH [4] to get meaningful and relia - ble results for your sequencing data. 16S/ ITS analysis includes extensive quality fil - tering, denoising of operational taxo - nomic units (OTU), taxonomic classifi - cation based on various databases and alpha diversity analysis (i.e. OTU diver - sity within a given sample). Depending on the aim of the study and the exper - imental design (conditions, replicates), Microsynth also offers a complementary module for comparative statistics. This module includes beta diversity analysis (i.e. OTU diversity across samples) and determination of differentially abun - dant OTUs including appropriate statis - tical measures. The results are presented in an interactive and understandable format, including guidance through the results by our bioinformatics experts. Figure 2. Microsynths workflow for amplicon metagenomics projects. The workflow can be entered and exited at various steps dependent on the customers' requirements. Example Results of the 16S/ITS Analysis Microsynth’s analysis pipeline provides you with a full characterization of the microbial communities in your samples. Alpha diversity measures provide an overview on OTU richness and diversity within the samples (see Figure 3 ). Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fl71fl722fl83 33 ? Fax + 41fl71fl722fl87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing Figure 3 . Examples for alpha diversity results. 3A. Rarefaction curves indicating whether sampling and sequencing covered the sample richness. 3B. Alpha diversity measures for the analyzed community including observed richness, Chao 1 indices representing the estimated richness and the Shannon diversity indices. 2U6p !`@t˜7„Y& C($”@# %ˆTdEGW BiSƒ126` 1`D… 4 81‰ 6Xpgg™pu 0i&?’†?1x7 “ 1`(5 2@Tƒ †ua 9b‘eCc@u  ƒF„'2?1V "&9aƒ6Q‰c H(56a Yq?#Y6g22%† 2e H…™`B
hy$ sˆ8v sˆ8v&re) @uC q‡c#P“1&` sˆ8v $
—H c€‰sga’†8
E€ ph„€ 7U8€9‚„vˆ3dWAD 0i’y
0 ‘s&%2 53‚˜QVxV5?c? )s1& TG4 )…w‚“ F UpU‘„$@6Q‰c F UpU‘„$@6Q‰c F UpU‘„$@6Q‰c F UpU‘„$@6Q‰c F UpU‘„$@6Q‰c F UpU‘„$@6Q‰c F UpU‘„$@6Q‰c F UpU‘„$@ A’u F4€—I ? –q2(‡eb€ )…w‚“1wg" –q2(‡eb€ )…w‚“(‡#1 –q2(‡eb€ )…w‚“YB— –q2(‡eb€ )…w‚“A6H9D –q2(‡eb€ )…w‚“!s4 & –q2(‡eb€ )…w‚“7F…C„ !hV18X&?"……e ˆ)™s? d™q`!X@”@)DQS 4@&p 7U8€BrT@ 88wyqgID 6"d) uS„p `XD5U„ 2e“1&` BDv!`@t˜7`c BQ@X QVxV5?c?6'e—S A’u 3IbA ’"!4R•d 2W–(`Hi 8˜7?93Q#u‘4R•d 4RqsP`Hi bBy4R•d „3F?%q“ 3„4!s)•ƒ`Ap"QY(”fI ! q‰‚ &X%4x9 •ˆ 0hB
g" ™S7  3„4!s)•ƒ`7F€“&?’†?1gƒ †0)yPBBuU?ƒiYS †0)yP ‘!Et ™S7  2 ‰Ap"QYƒiYS †0)yP ƒF„@’C &%2 Hq6S 2 ‰Ap"QY'XH5 4Wy6F&‘U C XB`PyI70 !‚8@ A’u 3IbA&G! ƒ q‘ "1G 9hwc$Ss”‰`4R•d 4RqsP%q“ bwix5ƒsE4R•d 98D c?w@ !FyH †0)yP"w5™@!I&i‚† "6† ˜@2ˆ 0Q`"w5™‰Rs0 †0)yP `XD7Vt@˜ 3„4!s)•ƒ` –
 ƒF„)˜ƒw– ‰Rs0 †0)yP4ps†V†0)yP #@c5U &by–”Dwx€ †0)yP ƒF„Pb F&‘U 1hD”"1G ’"!8
E€ A’u &? )d2S4R•d 0
q@`Hi 0bS—( h$‚4R•d 0
q@"1G #c? ‚4R•d 0
q@5"(„ 3„4!s)•ƒ`Ap"QY(”fI ! q‰‚ &X%4x9 •ˆ 0hB
g" ™S7  3„4!s)•ƒ`7F€“&?’†?@ †0)yP ƒF„)˜ƒw– (‡3 —QX€•‰X` Y"‡Y"‡ 0h3F‘&%2 Hq6S ˆV$y2i‚ —dvb–‰7„Y& XHs F&‘U @ESƒs"1G “cUf€8
E€ A’u HVƒ†P &F†(4R•d #…1–%3 dW% #T83E4R•d ’)€`Hi C%B#4R•d ’)€ggP 3„4!s)•ƒ`Ap"QY(”fI ! q‰‚ &re)2eF7BPx "!tC“Ap"QY(”fI ! q‰‚ g(qyhI y2i‚% A„2eF q3?$f4†c Ap"QY(”fI ! q‰‚ AD("w5™X?‡? "!tC“ Ap"QY(”fI #tc"( 6”g‚– !yvg(”fI 'XH5 "w5™@!I†0)yP #@c5U Xˆy BI37GE• –1&?’†?%U7yG S?™C—BV sˆ8v&—T5 EH– A’u #S‘w y#V4R•d 01Eƒ( •T bwixYg˜4R•d #…1"1G &QvE4R•d Ce„S 3„4!s)•ƒ`Ap"QY(”fI ! q‰‚ &X%4x9 •ˆ 0hB
g" ™S7  3„4!s)•ƒ` –
4ps†V @ †0)yP ƒF„1 ™S7  I‰2™!@ (”fI ! q‰‚&%2 Hq6S I‰2™!@(”fI ! q‰‚ 1hD”( •T 4R•d 6 `(!0$y– A’u B˜?& 4RqsPdW% #7 3b?a#"V‚))d?h4R•d #…1"1G #"V‚))d?h!FyH †0)yP"w5™@!I`2“p X?‡?"w5™ƒiYS †0)yP"w5™@!Id P1P uS„p"……e &Eu”02eF q3?ƒiYS †0)yP"w5™@!Ih!%˜ !yvg(”fI 'XH5 "w5™@!IHcI@ AD("w5™X?‡? "!tC“ Ap"QY(”fI ! q‰‚&%2 Hq6S UDq AFf
@ (”fI0h%U!0 40QP %U!0 1`D… &?’†?)•ƒ` q„B2U6p 4R•d ƒ q‘ `Hi A’u 'w”˜@ 2W–(8sa’T 07SI7 7“VyG‰€(U2†B ˜ ™3„4!s)•ƒ`Ap"QY(”fI ! q‰‚ &re)2eF7BPx "!tC“Ap"QY(”fI ! q‰‚ g(qyhI y2i‚X?‡?"w5™ƒiYS )•ƒ`Ap"QY (”fI ! q‰‚ F„&tx8 U€Q‘0 0“087`cHcI@ F„&tx8 &Da‚ 7GE• 4ƒ1t4$†$g &%2 Hq6S F„&tx8 U€Q‘0 0“08T0 0bS—5"(„ 8sa’T 9™fˆ?0QX` A’u 9hI2“ 2W–(4V—RS VT‚? ’†"X)ˆs™c'X@yDpi2&03„4!s)•ƒ`Ap"QY(”fI ! q‰‚ &X%4x9 •ˆ 0hB
g" ™S7  3„4!s)•ƒ`7F€“&?’†?1gƒ †0)yP6Q‰c"!tC“ 7F€“0S& #7U8€ )…w‚“ 6”g‚– !yvg(”fI Y"‡ 8X&•%P)pH &%2 Hq6S AD("w5™X?‡? 7„Y& XHs "s1’ 6 `(!%e'V bv)) Table 2. This detail of a sortable results table lists relative abundances and taxonomic identification of observed OTUs in the different samples. For taxonomic classi - fication confidence values are calculated and OTUs are only classified up to a specific rank if its confidence value is above a preset threshold to avoid dubious classifi - cations and false-positive results. sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v 2 ‡ Y7v‚V 2 ‡ Y ga’† 2 ‡ Y s?V 
2XG–‰6r‘P SQ% C6HI "4t4tty? "svy? $2U‡ 6ƒhQ Dub‘ &F@` sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v 
2XG –‰6r‘P 1ga?3 r"Y$ €A1@ ‘y @v—€ ’!RUP 7
R1„P €A1@ ‘y @v—€ ’!RUP 7
R1„P €A1@ ‘y @v—€ ’!RUP 7
R1„P s?V E‰€`? ˜… "svy? $2U‡ 6ƒhQ I2`™ !4‡v "svy? $2U‡ 6ƒhQ I2`™ !4‡v …’—‰ 9™BGP 6fF#H 60€‚ sˆ8v sˆ8v!y‚c ABWaG YQ‰)p Various reference databases are avail - able for the taxonomic classification of OTUs. Classifications are only shown to the taxonomic level, where the classi - fication fulfills certain confidence cri - teria in order to prevent false positive results. All observed OTUs are displayed together with their taxonomy and the relative abundance within the samples (see Table 2 ). Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing References [1] https://earthmicrobiome.org/protocols-and-standards/16s/, accessed June 2021 [2] Klindworth et al. (2013) Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies, Nucleic Acid Res, 41, e1. [3] White et al. (1990) Amplification and sequencing of fungal ribosomal RNA genes for phylogenetics, in PCR protocols. A guide to methods and applications, San Diego, Academic Press Inc., 315–322. [4] Edgar (2016) UNOISE2: Improved error-correction for Illumina 16S and ITS amplicon reads. bioRxiv, 081257, doi: https://doi.org/10.1101/081257. Comparative Statistics Microsynth’s comparative statistical module requires an adequate experi - mental design including sample repli - cates and at least two conditions that can be compared (e.g. treatment versus control). To obtain statistically valid results, we recommend using at least three biological replicates per condi - tion. The analysis includes beta diver - sity calculations which are presented in various graphs including principal com - ponent analysis plots (see Figure 4A ) and network or tree graphs display - ing similarities and differences between the samples. The major outcome of this module is the identification of OTUs that are differentially abundant between the chosen conditions together with appro - priate statistical measures. The differen - tially abundant OTUs are summarized in an interactive table, allowing an easy identification of significant changes in an OTUs abundance (see Figure 4B ). Figure 4. Examples for beta diversity results. 4A. Principal component analysis plot to visualize sample clustering. 4B. This detail of a results table shows differential abundance of OTUs between two conditions, including statistical measures for differential abundance (log fold change) and significance (adjusted p-value). base - Mean: mean OTU size; lfcSE: standard error; stat: Wald statistic; p-value: Wald test p-value; padj: p-value adjusted for multiple testing. Other Analysis Possibilities for Microbial Communities For the analysis of the functional poten - tial of a microbial community, shotgun metagenomics is the method of choice. We offer a full shotgun metagenomics service providing you with full flexibil - ity regarding the analysis of your results. For further information see our shotgun metagenomics application note. In case you are interested in the actively expressed genes of a microbial commu - nity our shotgun metatranscriptomics service offers an appropriate solution. 2U6p !`@t˜7„Y& C($”@# %ˆTdEGW BiSƒ126` 1`D… 9b‘eC A0%9” 6r‘P&A'… "&9aƒ%f6tu ’Sw7a Yq?"eFP&‰T@ 6CgV 9bi@)g˜˜ q‡c#P (#‡2B2 Y7•1–™ 3&’w H2wa %gPFR U‘„$@˜R‘T!vU‘„$@ $€‘ ga’†@T
ga??B BRG$gHY ph„€ 'A˜TC@&„Y %f6tu 'A˜TC@&„Y %f6tu 'A˜TC@&„Y %f6tu 'A˜TC@&„Y %f6tu 'A˜TC@&„Y %f6tu 'A˜TC@&„Y %f6tu ”V8F 1'“‰U!?#X uR“pAE4“94@!ˆ uS„p 9™dP„s„ 1 5@5?ˆ %s7&‚8"€ ! uS„p 1`D… Bh14P'b ‰‡0 4ƒ1tRi@ X
`cV&`1a p 7`c6 `(! ”V8F B‚PfU Q@`Hi €†G?˜W7rW”g )RY'A‡‘ ˜t€ gV™u8DC W„C C XB`@2g8 €†i?i90 G?˜WA”ed& €†#Wƒ“ ”V8F B‚PfU0`?@ A6˜1…"1G 0D?x? )RY'@ESƒs rX? #"V‚)t” `)?@ t” `”‡w˜P !3x84R•d 7q• $€‘ ?0QX` ”V8F &v8” 5"(„'41F v€˜5"(„ T30ƒuqp3xT``#vb G?˜W15uh €†A6˜1… C XB`3…ˆ‘' €†tR3I ”V8F 7U vu—† 2U6p €†G?˜Wa1W )RY')?@ 2 4PY 4‰Uˆ3xT``4R•d C XB`4C6† @x„–#"V‚) CS!15uh @x„– sˆ8v ”V8F 9wx€x %"
„`Hi $Dr’†7  1$Q‰$!p9)32w?4

0‡ ˆtrhh7Vc $€‘ 2#!9# C XB`“Y ‚` $€‘ E‰€`? ”V8F `R— &‚'A"1G €†ˆtrh1@?„D )RY')?@ xc6 gUC
G?˜Wbwix ˆtrh”‡w˜P @x„–AX P‡ ( •T”‡w˜P @x„–&—T5 ”V8F 2‚„49 %A?rItQ €†t” `0c…8 )RY'7Q h &‚'A @x„–)RY'5"(„ #p“2A 3 ˆ’q’`e Q8Ai 3 ˆ’q%A? ”V8F u!Q 5v2’‘–%3 ‡xc`rItQ )Xr(”…5R32w?u1ƒv@ )‘Y"d?1˜ €†%4G4 C XB`3S‡2 €†˜YVh 2U6p @CB –
rIb Y"‡ 7’" XBi 7„Y& –
"iPa' 3FRi‡ 6r‘P6r‘P6r‘P Af4%C 7PvQP 3BS @‰—i I•@? ‘@# 3“ST `‰g` —Qs  ™W '‡6s 5‡ Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing