MICROSYNTH FRANCE SAS

Contract research capabilities in the field of molecular genetics delivered how, where and when you need it. Microsynth has been founded more than 30 years ago as a DNA and RNA oligo synthesis service company. Step by step, additional services such as Sanger sequencing, polymerase chain reaction (PCR), real-time PCR (qPCR) and digital PCR services, and Next- Generation Sequencing (NGS) were added. By now, a comprehensive toolbox covering the realm of molec - ular genetics is at Microsynth’s dispo - sition. Microsynth’s skills in combining the different methods to establish a tai - lored workflow to successfully meet the customer’s demand has constantly grown with each project and challenge mastered. Here, we want to provide an overview how Microsynth can suit customers with different needs in con - tract research capabilities, including clients who need to comply with reg - ulatory demands. In a general view, the relevant core parameters in molecular genetics are the sequences of DNA and RNA mol - ecules, as well as by the abundance of DNA and RNA molecules with a given sequence identity. Or, in other words, the main analytical tasks are (1) to decipher or to produce the correct DNA and RNA sequences, and (2) to count or quantify DNA and RNA mol - ecules with a given sequence. In addi - tion (3), data interpretation consists of comparing sequences and their abun - dances to references and/or among different samples. In the light of this, the main methods of our portfolio are shortly discussed, with advantages and limitations. Custom Contract Research Services Introduction Scientific Methods Expertise Sanger sequencing is useful to deci - pher the DNA sequence of molecules up to 1’000 nucleotides per reaction. A DNA primer and sufficient tem - plate DNA are required for its success. Therefore, for each reaction, some sequence information must be known, and it cannot be directly applied on genomic DNA without a preceding PCR amplification. Sanger sequenc - ing is relatively fast and cheap, and it is mostly limited to homogenous samples. Next Generation Sequencing (NGS), typically performed on the Illumina sequencing platforms (see Figure  1 ), in turn provides massive parallel sequencing of millions, even billions of molecules. This allows the determina - tion of up to 2’400 Gb in one sequenc - ing run. In principle, no prior sequence information is required, however, the focus on defined sequences via ampli - con sequencing represent a wide - spread application. NGS has revo - lutionized molecular genetics and opened a wealth of new applications. However, the read length of Illumina sequencing reaction is limited to 300 nucleotides paired-ended. This means that long DNA molecules, for example genomes, are fragmented into multi - ple small pieces for sequencing. The sequence information of the long original fragments needs to be recon - structed with computational methods, which are limited, especially due to the presence of repetitive sequence. More recently, long-read sequencing technologies such as Oxford Nanopore or PacBio have been developed to overcome these limitations and are increasingly popular to complement or even substitute Illumina short-read sequencing. The disadvantage of short Illumina reads does not apply to short templates such as cDNA derived from transcribed RNA, or PCR amplicons of up to about 500 base pairs (bp). In addition to identifying DNA and RNA sequences, NGS can also be used to count molecules. For example, Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41ff71ff722ff83 33 ? Fax + 41ff71ff722ff87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY White Paper ? Next Generation Sequencing using RNA sequencing the abun - dance of a given mRNA is determined by assessing the number of normal - ized reads. Similarly, the abundance of a given microbial species is deter - mined by the relative number of matching sequences using an ampli - con metagenomics approach. A similar logic applies to the fraction of success - ful edits in a CRISPR/Cas9 experiment. To precisely determine the number of specific RNA or DNA molecules at rela - tively lower cost and in higher sample throughput settings compared to NGS, PCR methods are recommended, spe - cifically quantitated real-time PCR (qPCR) or digital PCR. With qPCR, the amount of amplified DNA is measured upon each PCR cycle, taking advantage of the activation of fluorescence upon product formation. The number of PCR cycles required to reach a certain signal threshold correlates with the amount of starting template. However, the actual efficiency of each amplification cycle must be considered to correctly infer the amount of starting material. In contrast, digital PCR is almost insen - sitive to reaction efficiency, as long as the reaction produces a signal discern - able from background. Unlike qPCR, dPCR reactions are compartmental - ized into 20’000 distinct sub-reactions (droplets), each of which contains a single template molecule on average. The outcome of each sub-reaction is then qualified as either positive or negative. The number of positive reac - tions directly relates to the number of template present in the reaction. Thus, dPCR allows direct counting of tem - plate molecules and is less suscepti - ble to PCR inhibition effects from the matrix. These advantages translate to increased robustness and precision of dPCR compared to qPCR. On the other hand, dPCR is more costly; thus, qPCR will remain useful where precision and robustness is not of prior importance. For example, Figure 1. Operator using Illumina MiSeq Sequencer. Figure 2. Operator loading the liquid handler for DNA / RNA isolation. Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY White Paper ? Next Generation Sequencing Bringing it All Together To address the specific customer needs, different methods are combined in customized analysis workflows. All experimental results are critically eval - uated to determine how reliably they describe and represent the actual samples. Thereby can Microynth con - tribute to the safety of drug products for the consumer and patients, and to fulfill regulatory documentation and experimental guidelines requested by US and European authorities. An important resource is issued by the The International Council for Harmonisation of Technical Requirements for Pharmaceuticals for Human Use (ICH) (https://www.ich.org/). At Microsynth, we identify the relevant experimental parameters and assays to be addressed based on ICH guidelines. For example, when setting-up a method, Microsynth will evaluate its robustness. This allows identifying how parameters such as temperature, reagent concentrations, DNA or RNA isolation procedures, etc. affect the results. Precision refers to how variable the results are when a given assay is repeated on different days with different operators, reagent lots, or even in different laboratories (intermediate precision). Accuracy describes how close the determined results is to the true result, which refers to the value obtained with an alterna - tive method that could be considered the gold standard. Different questions are addressed for distinct drug prod - ucts: Identity confirmation, impurity detection or quantification and quan - tification of an active compound. As outlined above, in molecular genetics, we work with DNA and RNA sequences and with sequence counts and concentrations of DNA and RNA molecules, which simplifies the task if for example compared with poorly defined drug products arising from complex chemical or biological syn - thesis workflows. Accordingly, we design the experimen - tal workflow accompanied by appro - priate documentation to meet the reg - ulatory requirements. The foundation for the formal reporting is represented by our quality management system with the ISO 9001:2015 and EN ISO 13485:2016 certifications, the accredi - tation according to ISO/IEC 17025:2017 (STS 0429) for Sanger Sequencing, Next Generation Sequencing and Fragment Length Analysis and the GMP Compliance issued by Swissmedic for our Sanger Sequencing department. Processes are clearly defined, vali - dated, and controlled, and described in procedures and Standard Operating Procedures (SOPs), which are reviewed periodically. Instruments are qualified with periodic re-qualification periods, and corresponding instrument test documents are archived. Changes that affect the quality are validated. In cases where the quality cannot be covered by verification, the produc - tion process is validated. Operators are trained regularly in practical work and documentation procedures. All lab - oratory processes, including the bio - informatic analyses, are documented in lab data sheets, where time and date, operator, working procedures, reagent lot numbers and machine serial numbers are recorded. Finally, a summary report is produced describ - ing the findings with reference to all primary data and analysis. The doc - umentation and related records are maintained in a controlled manner. This includes the approval and release by our quality assurance unit. Below we will describe a few cases to illus - trate our approaches. These analytical procedures are sup - ported by our isolation services that perform DNA and RNA extractions from diverse matrices including envi - ronmental samples such as soil or air, animal and plant tissue biopsies, stool, blood and urine samples, to name a few (see Figure  2 ). Furthermore, primers and oligos needed for NGS and PCR can be synthesized in house, which facilitates shorter production timelines and flexibility. Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41ff71ff722ff83 33 ? Fax + 41ff71ff722ff87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY White Paper ? Next Generation Sequencing Case 2: Transgene Copy Number in Production Strains Production of some vaccines are based on the production of specific proteins, for which transgenic pro - duction strains are used. One of the requirements is to confirm that the copy number of the transgene is stable through the production process. In the early development step, Microsynth designed and tested the functional - ity of a duplex dPCR assay to measure transgene copy number for the respec - tive vaccine program of the sponsor. In a second step, reference material was constructed and qualified before a full qualification was run address - ing the parameters: specificity (spe - cific amplification of locus and matrix effects), accuracy, intermediate preci - sion, repeatability, linearity, and range, as well as limit of detection and limit of quantification. Results of the study were reported in a qualification report. Case 3: Measuring CRISPR/Cas9 Off-Target Editing Although CRISPR/Cas9 editing is far more precise than previous genome editing technologies, some off-target editing may occur and must be tested in drug products. The editing rates observed in the off-target loci are sig - nificantly lower than for the on-tar - get locus. Thus, accurate and precise measurements below 2 % editing rates are required, which is challeng - ing. The method of choice for such low-frequency editing rates is ampli - con deep-sequencing. Based on dis - cussions with our sponsor we qual - ified and validated the amplicon sequencing strategy that included an elaborated robustness testing and the validation of the method against pre-defined criteria set by the sponsor. Case 1: Sequence Stability of a Bacterial Production Strain To verify that no unwanted mutations accumulated in a bacterial produc - tion strain, the genomes of the refer - ence master strain and several derived production strains were determined. For this, a long-read next generation sequencing approach with PacBio was chosen in parallel with short-read Illumina sequencing. The long reads, up to about 30 kb in length, were used to produce the de novo chromo - some assemblies. In parallel, Illumina short reads were generated and used to reduce the remaining sequenc - ing errors in the contigs. The final sequencing contig of the reference master strain was then used to identify and confirm the species identity, using average nucleotide identify and digital to digital sequence hybridization strat - egies. Publicly available database resources provided the references. Finally, the newly produced genome sequences from the strains in the pro - duction process were compared to the genome of the reference strain. Any nucleotide changes were listed according to position. These bioinfor - matic analyses have confirmed that no unwanted mutations arose during the production process. Conceptually, this task may be regarded as identity test, where identity refers to the genome sequence of the test item. Contact Hopefully, we have been able to provide you with a better understanding how we can help you with your projects and we are looking forward to advising you and designing a work procedure to support your research or drug product develop - ment. To request information or arrange to visit Microsynth, please contact us at: info@microsynth.ch Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41ff71ff722ff83 33 ? Fax + 41ff71ff722ff87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY White Paper ? Next Generation Sequencing

High Quality and Consistency Providing comprehensive hands-on expertise in the synthesis of a broad range of ASO chemistries, combined with highly optimized synthesis platforms. The result is oligonucleotides of the highest quality. Fast Turnaround Times High scalability and adaptability of the production processes provide you with fast turn-around times for your drug discovery process. Attractive Prices Tailor-made and highly automated manufacturing processes create ASOs, siRNAs, and other oligonucleotides for potential therapeutic applications at attractive prices. Antisense Oligonucleotides for Early Drug Discovery Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41ff71ff722ff83 33 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANYFlyer ? Oligonucleotide Synthesis Overview Several oligonucleotide-based drugs have been approved by regulatory agencies (e.g. FDA and EMEA) during the past two decades. Antisense and RNAi therapeutics - which are cur - rently amongst the hottest topics in the world of research and develop - ment - are forms of treatments that are clearly distinguished from traditional approaches such as the small mole - cule or antibody-based approaches. Since they can be directed against a broad variety of RNA targets (i.e. premRNA, mRNA, lncRNA, miRNA), they open the door to the treatment of a wide range of diseases, including those that are considered undrugga - ble on the protein level. Microsynth is a well known oligo sup - plier with more than three decades of experience. We have developed tech - nical capabilities and expertise that enable us to offer a portfolio of ther - apeutic oligonucleotides, which are especially suited for leveraging your early drug discovery program in this field. Microsynth Core Competency Areas to Support Your Drug Discovery Program Figure 1. Steps of a typical process for the discovery of therapeutic oligos, where Microsynth can support you. A list confirming the typical services provided by Microsynth gives you an insight into our exten - sive service portfolio. Product Specifications and Services Backbones and Modifications DNA, RNA, 2’ MOE, 2’ OMe, LNA, PTO, 2’F, GalNAc, S-cEt 1 Purification • RP HPLC (single and dual) • IP RP HPLC • IEX HPLC • Dialysis Quality Control and Documentation • Online Trityl monitoring • MALDI-TOF • Analytical HPLC • Various Certificates of Analysis Available Products • Antisense oligonucleotides (ASO) • siRNA • Anti-microRNA (AMO) • Aptamers • CpG oligonucleotides Getting Started with Microsynth Our modular integrated synthe - sis process gives us the flexibility to accommodate your project at any stage of your discovery program. Please contact one of our project man - agers to discuss your personal program and needs. Our dedicated experts will then create a customized project pro - posal and timing schedule for you that we are confident will meet your expec - tations. 1) On request - High-throughput synthesis of screening oligos - Broad range of synthesis chemistries and modifcations - Flexible and fast production times - Batch sizes up to 200 oligos - larger sizes are possible if you wish to discuss this option Drug Discovery and Screening Lead Optimization - Highly modifed oligos (multiple diferent modifcations are possible) - Manufacturing from nmol to mg quantities - Broad spectrum of post-synthetic conjugation techniques (e.g. termi- nal GalNAc conjugates) - Customized processes Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41ff71ff722ff83 33 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANYFlyer ? Oligonucleotide Synthesis

Explore the microbial community composition of your samples Compare taxonomic shifts within a given experimental setup Introduction Microbial communities are present in almost every environment. They are important drivers of biogeochemical processes, have a large influence on human health and harbor enormous potential for biotechnological applica - tions. A major goal in the analysis of a microbial community is to identify its taxonomic composition and diversity. Sequencing of the ribosomal RNA (rRNA) gene and its internal spacer regions has become the gold standard for the identi - fication of microorganisms such as bac - teria, archaea and fungi. Its presence in all living organism, the combination of conserved and hypervariable genetic regions and the availability of curated reference databases make the rRNA gene an ideal phylogenetic marker. The com - bination of next generation sequencing (NGS) of partial regions of the rRNA gene combined with adequate bioinformatics analysis is a powerful tool to explore the composition of microbial communities. Amplicon Metagenomics – 16S/ITS Choice of the Primer System Amplicon metagenomics is based on NGS sequencing of the microbial rRNA gene. Since NGS read lengths are limited, only parts of the rRNA gene can be amplified and sequenced. For prokaryotes, the analysis targets hyper - variable regions (V1-9) on the 16S rRNA gene, while for fungi the internal tran - scribed spacer regions (ITS) are used for taxonomic profiling (see Figure 1 ). An ideal primer system should be uni - versal enough to cover a broad range of taxonomic groups, while the result - ing amplicon must provide enough tax - onomic information for a reliable tax - onomic classification. Based on our experience and the validation of our 16S/ITS analysis pipeline, we recom - mend the primer systems displayed in Table 1 . Our service is not restricted to the displayed marker genes and primer systems, also other phyloge - netic marker genes (e.g. cytochrome c oxidase I) and primer systems can be used. A pilot study can be very helpful to find the best primer system for your specific research question. Figure 1. Overview of loci of ribosomal gene loci commonly used for the taxonomic analysis of microbial communities. Hypervariable regions are marked in green while conserved regions are marked in grey. A. Structure of the prokaryotic 16S rRNA gene showing the nine hypervariable regions (V1-V9) and the regions targeted by the commonly used primer systems. B. Organization of the fungal rRNA gene operon showing two internal transcribed spacer regions (ITS). ITS2 is most often used for profiling fungal communities. Primer Name Sequence (5’-3’) Region Size (bp) Source 515F (Parada) 806R (Apprill) GTGYCAGCMGCCGCGGTAA GGACTACNVGGGTWTCTAAT V4 ~300 [1] 341F 805R CCTACGGGNGGCWGCAG GACTACHVGGGTATCTAATCC V34 ~460 [2] ITS3 ITS4 GCATCGATGAAGAACGCAGC TCC TCCGC T TAT TGATATGC ITS2 300-400 [3] Table 1. Recommended and commonly used universal primer systems for prokaryotic (515F/806R, 341Fl/805R) and fungal (ITS3/ITS4) microbiome profiling. Only template specific sequences are shown. For Illumina-Sequencing the primer sequences must be combined with Illumina adaptor sequences in a two-step PCR approach. For further information consult our application note for Amplicon Deep Sequencing (https:// www.microsynth.ch/amplicon-deep-sequencing.html). Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fl71fl722fl83 33 ? Fax + 41fl71fl722fl87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing Microsynth Competences and Services Microbial community profiling is one of Microsynth’s core competences. Based on our extensive experience, we provide a one-stop service from experimental design to bioinformatics analysis (see Figure 2 ). You can either outsource the whole process or only single steps to us. We validated our whole amplicon metagenomics pipeline and the includ - ing methods by sequencing and analysis of two well characterized mock commu - nities. For further information on our val - idation process and possibilities to vali - date your own study, please contact us. Experimental Design The gain and impact of a study is highly dependent on its experimental design. The use of replicates, controls and appro - priate sampling methods are only a few examples of important points to con - sider. Make use of our experience; our NGS specialists will assist you from the start. DNA Isolation Microorganisms are highly diverse regarding their physiology and are often associated with surfaces like soil particles or are organized in stable agglomera - tions such as biofilms. DNA extraction of complex matrices is challenging. You can either perform the extraction yourself or outsource this critical step. Microsynth has extensive experience in DNA and RNA isolation from various matrices (e.g. soil or feces). PCR Amplification PCR amplification follows a two-step protocol. In a first step the locus-specific sequence is amplified, while in a second step the Illumina sequencing adaptors and indices are added. For projects with very low amounts of starting material we recommend our three-step PCR protocol including two subsequent locus-specific PCRs to increase the yield of sequence- able amplicons. NGS Sequencing Sequencing is performed on the Illumina MiSeq system. The MiSeq allows high throughput profiling at low cost, sup - porting read lengths up to 2x300 bp. Bioinformatics Analysis Microsynth’s amplicon metagenomics analysis is based on up-to-date and pub - lished bioinformatics software such as USEARCH [4] to get meaningful and relia - ble results for your sequencing data. 16S/ ITS analysis includes extensive quality fil - tering, denoising of operational taxo - nomic units (OTU), taxonomic classifi - cation based on various databases and alpha diversity analysis (i.e. OTU diver - sity within a given sample). Depending on the aim of the study and the exper - imental design (conditions, replicates), Microsynth also offers a complementary module for comparative statistics. This module includes beta diversity analysis (i.e. OTU diversity across samples) and determination of differentially abun - dant OTUs including appropriate statis - tical measures. The results are presented in an interactive and understandable format, including guidance through the results by our bioinformatics experts. Figure 2. Microsynths workflow for amplicon metagenomics projects. The workflow can be entered and exited at various steps dependent on the customers' requirements. Example Results of the 16S/ITS Analysis Microsynth’s analysis pipeline provides you with a full characterization of the microbial communities in your samples. Alpha diversity measures provide an overview on OTU richness and diversity within the samples (see Figure 3 ). Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fl71fl722fl83 33 ? Fax + 41fl71fl722fl87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing Figure 3 . Examples for alpha diversity results. 3A. Rarefaction curves indicating whether sampling and sequencing covered the sample richness. 3B. Alpha diversity measures for the analyzed community including observed richness, Chao 1 indices representing the estimated richness and the Shannon diversity indices. 2U6p !`@t˜7„Y& C($”@# %ˆTdEGW BiSƒ126` 1`D… 4 81‰ 6Xpgg™pu 0i&?’†?1x7 “ 1`(5 2@Tƒ †ua 9b‘eCc@u  ƒF„'2?1V "&9aƒ6Q‰c H(56a Yq?#Y6g22%† 2e H…™`B
hy$ sˆ8v sˆ8v&re) @uC q‡c#P“1&` sˆ8v $
—H c€‰sga’†8
E€ ph„€ 7U8€9‚„vˆ3dWAD 0i’y
0 ‘s&%2 53‚˜QVxV5?c? )s1& TG4 )…w‚“ F UpU‘„$@6Q‰c F UpU‘„$@6Q‰c F UpU‘„$@6Q‰c F UpU‘„$@6Q‰c F UpU‘„$@6Q‰c F UpU‘„$@6Q‰c F UpU‘„$@6Q‰c F UpU‘„$@ A’u F4€—I ? –q2(‡eb€ )…w‚“1wg" –q2(‡eb€ )…w‚“(‡#1 –q2(‡eb€ )…w‚“YB— –q2(‡eb€ )…w‚“A6H9D –q2(‡eb€ )…w‚“!s4 & –q2(‡eb€ )…w‚“7F…C„ !hV18X&?"……e ˆ)™s? d™q`!X@”@)DQS 4@&p 7U8€BrT@ 88wyqgID 6"d) uS„p `XD5U„ 2e“1&` BDv!`@t˜7`c BQ@X QVxV5?c?6'e—S A’u 3IbA ’"!4R•d 2W–(`Hi 8˜7?93Q#u‘4R•d 4RqsP`Hi bBy4R•d „3F?%q“ 3„4!s)•ƒ`Ap"QY(”fI ! q‰‚ &X%4x9 •ˆ 0hB
g" ™S7  3„4!s)•ƒ`7F€“&?’†?1gƒ †0)yPBBuU?ƒiYS †0)yP ‘!Et ™S7  2 ‰Ap"QYƒiYS †0)yP ƒF„@’C &%2 Hq6S 2 ‰Ap"QY'XH5 4Wy6F&‘U C XB`PyI70 !‚8@ A’u 3IbA&G! ƒ q‘ "1G 9hwc$Ss”‰`4R•d 4RqsP%q“ bwix5ƒsE4R•d 98D c?w@ !FyH †0)yP"w5™@!I&i‚† "6† ˜@2ˆ 0Q`"w5™‰Rs0 †0)yP `XD7Vt@˜ 3„4!s)•ƒ` –
 ƒF„)˜ƒw– ‰Rs0 †0)yP4ps†V†0)yP #@c5U &by–”Dwx€ †0)yP ƒF„Pb F&‘U 1hD”"1G ’"!8
E€ A’u &? )d2S4R•d 0
q@`Hi 0bS—( h$‚4R•d 0
q@"1G #c? ‚4R•d 0
q@5"(„ 3„4!s)•ƒ`Ap"QY(”fI ! q‰‚ &X%4x9 •ˆ 0hB
g" ™S7  3„4!s)•ƒ`7F€“&?’†?@ †0)yP ƒF„)˜ƒw– (‡3 —QX€•‰X` Y"‡Y"‡ 0h3F‘&%2 Hq6S ˆV$y2i‚ —dvb–‰7„Y& XHs F&‘U @ESƒs"1G “cUf€8
E€ A’u HVƒ†P &F†(4R•d #…1–%3 dW% #T83E4R•d ’)€`Hi C%B#4R•d ’)€ggP 3„4!s)•ƒ`Ap"QY(”fI ! q‰‚ &re)2eF7BPx "!tC“Ap"QY(”fI ! q‰‚ g(qyhI y2i‚% A„2eF q3?$f4†c Ap"QY(”fI ! q‰‚ AD("w5™X?‡? "!tC“ Ap"QY(”fI #tc"( 6”g‚– !yvg(”fI 'XH5 "w5™@!I†0)yP #@c5U Xˆy BI37GE• –1&?’†?%U7yG S?™C—BV sˆ8v&—T5 EH– A’u #S‘w y#V4R•d 01Eƒ( •T bwixYg˜4R•d #…1"1G &QvE4R•d Ce„S 3„4!s)•ƒ`Ap"QY(”fI ! q‰‚ &X%4x9 •ˆ 0hB
g" ™S7  3„4!s)•ƒ` –
4ps†V @ †0)yP ƒF„1 ™S7  I‰2™!@ (”fI ! q‰‚&%2 Hq6S I‰2™!@(”fI ! q‰‚ 1hD”( •T 4R•d 6 `(!0$y– A’u B˜?& 4RqsPdW% #7 3b?a#"V‚))d?h4R•d #…1"1G #"V‚))d?h!FyH †0)yP"w5™@!I`2“p X?‡?"w5™ƒiYS †0)yP"w5™@!Id P1P uS„p"……e &Eu”02eF q3?ƒiYS †0)yP"w5™@!Ih!%˜ !yvg(”fI 'XH5 "w5™@!IHcI@ AD("w5™X?‡? "!tC“ Ap"QY(”fI ! q‰‚&%2 Hq6S UDq AFf
@ (”fI0h%U!0 40QP %U!0 1`D… &?’†?)•ƒ` q„B2U6p 4R•d ƒ q‘ `Hi A’u 'w”˜@ 2W–(8sa’T 07SI7 7“VyG‰€(U2†B ˜ ™3„4!s)•ƒ`Ap"QY(”fI ! q‰‚ &re)2eF7BPx "!tC“Ap"QY(”fI ! q‰‚ g(qyhI y2i‚X?‡?"w5™ƒiYS )•ƒ`Ap"QY (”fI ! q‰‚ F„&tx8 U€Q‘0 0“087`cHcI@ F„&tx8 &Da‚ 7GE• 4ƒ1t4$†$g &%2 Hq6S F„&tx8 U€Q‘0 0“08T0 0bS—5"(„ 8sa’T 9™fˆ?0QX` A’u 9hI2“ 2W–(4V—RS VT‚? ’†"X)ˆs™c'X@yDpi2&03„4!s)•ƒ`Ap"QY(”fI ! q‰‚ &X%4x9 •ˆ 0hB
g" ™S7  3„4!s)•ƒ`7F€“&?’†?1gƒ †0)yP6Q‰c"!tC“ 7F€“0S& #7U8€ )…w‚“ 6”g‚– !yvg(”fI Y"‡ 8X&•%P)pH &%2 Hq6S AD("w5™X?‡? 7„Y& XHs "s1’ 6 `(!%e'V bv)) Table 2. This detail of a sortable results table lists relative abundances and taxonomic identification of observed OTUs in the different samples. For taxonomic classi - fication confidence values are calculated and OTUs are only classified up to a specific rank if its confidence value is above a preset threshold to avoid dubious classifi - cations and false-positive results. sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v 2 ‡ Y7v‚V 2 ‡ Y ga’† 2 ‡ Y s?V 
2XG–‰6r‘P SQ% C6HI "4t4tty? "svy? $2U‡ 6ƒhQ Dub‘ &F@` sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v sˆ8v 
2XG –‰6r‘P 1ga?3 r"Y$ €A1@ ‘y @v—€ ’!RUP 7
R1„P €A1@ ‘y @v—€ ’!RUP 7
R1„P €A1@ ‘y @v—€ ’!RUP 7
R1„P s?V E‰€`? ˜… "svy? $2U‡ 6ƒhQ I2`™ !4‡v "svy? $2U‡ 6ƒhQ I2`™ !4‡v …’—‰ 9™BGP 6fF#H 60€‚ sˆ8v sˆ8v!y‚c ABWaG YQ‰)p Various reference databases are avail - able for the taxonomic classification of OTUs. Classifications are only shown to the taxonomic level, where the classi - fication fulfills certain confidence cri - teria in order to prevent false positive results. All observed OTUs are displayed together with their taxonomy and the relative abundance within the samples (see Table 2 ). Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing References [1] https://earthmicrobiome.org/protocols-and-standards/16s/, accessed June 2021 [2] Klindworth et al. (2013) Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies, Nucleic Acid Res, 41, e1. [3] White et al. (1990) Amplification and sequencing of fungal ribosomal RNA genes for phylogenetics, in PCR protocols. A guide to methods and applications, San Diego, Academic Press Inc., 315–322. [4] Edgar (2016) UNOISE2: Improved error-correction for Illumina 16S and ITS amplicon reads. bioRxiv, 081257, doi: https://doi.org/10.1101/081257. Comparative Statistics Microsynth’s comparative statistical module requires an adequate experi - mental design including sample repli - cates and at least two conditions that can be compared (e.g. treatment versus control). To obtain statistically valid results, we recommend using at least three biological replicates per condi - tion. The analysis includes beta diver - sity calculations which are presented in various graphs including principal com - ponent analysis plots (see Figure 4A ) and network or tree graphs display - ing similarities and differences between the samples. The major outcome of this module is the identification of OTUs that are differentially abundant between the chosen conditions together with appro - priate statistical measures. The differen - tially abundant OTUs are summarized in an interactive table, allowing an easy identification of significant changes in an OTUs abundance (see Figure 4B ). Figure 4. Examples for beta diversity results. 4A. Principal component analysis plot to visualize sample clustering. 4B. This detail of a results table shows differential abundance of OTUs between two conditions, including statistical measures for differential abundance (log fold change) and significance (adjusted p-value). base - Mean: mean OTU size; lfcSE: standard error; stat: Wald statistic; p-value: Wald test p-value; padj: p-value adjusted for multiple testing. Other Analysis Possibilities for Microbial Communities For the analysis of the functional poten - tial of a microbial community, shotgun metagenomics is the method of choice. We offer a full shotgun metagenomics service providing you with full flexibil - ity regarding the analysis of your results. For further information see our shotgun metagenomics application note. In case you are interested in the actively expressed genes of a microbial commu - nity our shotgun metatranscriptomics service offers an appropriate solution. 2U6p !`@t˜7„Y& C($”@# %ˆTdEGW BiSƒ126` 1`D… 9b‘eC A0%9” 6r‘P&A'… "&9aƒ%f6tu ’Sw7a Yq?"eFP&‰T@ 6CgV 9bi@)g˜˜ q‡c#P (#‡2B2 Y7•1–™ 3&’w H2wa %gPFR U‘„$@˜R‘T!vU‘„$@ $€‘ ga’†@T
ga??B BRG$gHY ph„€ 'A˜TC@&„Y %f6tu 'A˜TC@&„Y %f6tu 'A˜TC@&„Y %f6tu 'A˜TC@&„Y %f6tu 'A˜TC@&„Y %f6tu 'A˜TC@&„Y %f6tu ”V8F 1'“‰U!?#X uR“pAE4“94@!ˆ uS„p 9™dP„s„ 1 5@5?ˆ %s7&‚8"€ ! uS„p 1`D… Bh14P'b ‰‡0 4ƒ1tRi@ X
`cV&`1a p 7`c6 `(! ”V8F B‚PfU Q@`Hi €†G?˜W7rW”g )RY'A‡‘ ˜t€ gV™u8DC W„C C XB`@2g8 €†i?i90 G?˜WA”ed& €†#Wƒ“ ”V8F B‚PfU0`?@ A6˜1…"1G 0D?x? )RY'@ESƒs rX? #"V‚)t” `)?@ t” `”‡w˜P !3x84R•d 7q• $€‘ ?0QX` ”V8F &v8” 5"(„'41F v€˜5"(„ T30ƒuqp3xT``#vb G?˜W15uh €†A6˜1… C XB`3…ˆ‘' €†tR3I ”V8F 7U vu—† 2U6p €†G?˜Wa1W )RY')?@ 2 4PY 4‰Uˆ3xT``4R•d C XB`4C6† @x„–#"V‚) CS!15uh @x„– sˆ8v ”V8F 9wx€x %"
„`Hi $Dr’†7  1$Q‰$!p9)32w?4

0‡ ˆtrhh7Vc $€‘ 2#!9# C XB`“Y ‚` $€‘ E‰€`? ”V8F `R— &‚'A"1G €†ˆtrh1@?„D )RY')?@ xc6 gUC
G?˜Wbwix ˆtrh”‡w˜P @x„–AX P‡ ( •T”‡w˜P @x„–&—T5 ”V8F 2‚„49 %A?rItQ €†t” `0c…8 )RY'7Q h &‚'A @x„–)RY'5"(„ #p“2A 3 ˆ’q’`e Q8Ai 3 ˆ’q%A? ”V8F u!Q 5v2’‘–%3 ‡xc`rItQ )Xr(”…5R32w?u1ƒv@ )‘Y"d?1˜ €†%4G4 C XB`3S‡2 €†˜YVh 2U6p @CB –
rIb Y"‡ 7’" XBi 7„Y& –
"iPa' 3FRi‡ 6r‘P6r‘P6r‘P Af4%C 7PvQP 3BS @‰—i I•@? ‘@# 3“ST `‰g` —Qs  ™W '‡6s 5‡ Microsynth AG, SwitzerlandSch?tzenstrasse 15 ? P.O. Box ? CH - 9436 Balgach ? Phone + 41fi71fi722fi83 33 ? Fax + 41fi71fi722fi87 58 ? info @microsynth.ch ? www.microsynth.com THE SWISS DNA COMPANY Application Note ? Next Generation Sequencing